View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0488_low_11 (Length: 269)
Name: NF0488_low_11
Description: NF0488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0488_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 30 - 192
Target Start/End: Complemental strand, 30351449 - 30351286
Alignment:
| Q |
30 |
ctcatatacaattaaagccatattttgttttttaaaaaatatgcacaagtcaaaatgtatatgaaaatttacgaattttaattaatgaatattgaaagaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30351449 |
ctcatatacaattaaagccatattttgtttttaaaaaaatatgcacaagtcaaaatgtatatgaaaatttacgaattttaattaatgaatattgaaagaa |
30351350 |
T |
|
| Q |
130 |
actatggtaa-ctccaaaattatactatcatctagttatagaaggcaaggaactgagatgtcat |
192 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30351349 |
actatggtaaccgccaaaattatactatcatctagttatagaaggcaaggaactgagatgtcat |
30351286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 681 times since January 2019
Visitors: 3489