View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0488_low_13 (Length: 258)

Name: NF0488_low_13
Description: NF0488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0488_low_13
NF0488_low_13
[»] chr4 (1 HSPs)
chr4 (6-226)||(44104567-44104791)


Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 6 - 226
Target Start/End: Complemental strand, 44104791 - 44104567
Alignment:
6 ttattcttgtaaaactgagataacataactggtccagcccatacacaaatttggattgctttttccttatttctattatcactattatttttatacaatt 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44104791 ttattcttgtaaaactgagataacataactggtccagcccatacacaaatttggattgctttttccttatttctattatcactattatttttatacaatt 44104692  T
106 ctttagaatatttattgacatgttagtannnnnnnnattcactgagatttgaattatgatcattggaactctcttaagactttgtttgtattgatgaa-- 203  Q
    ||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      
44104691 ctttagaatatttattgacatgttagtatattttttattcactgagatttgaattatgatcattggaactctcttaagactttgtttgtattgatgaaat 44104592  T
204 --atatgatggaatggagtggtatg 226  Q
      |||||||||||||||||||||||    
44104591 atatatgatggaatggagtggtatg 44104567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 686 times since January 2019
Visitors: 3489