View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0488_low_8 (Length: 303)
Name: NF0488_low_8
Description: NF0488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0488_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 56 - 291
Target Start/End: Original strand, 18554696 - 18554931
Alignment:
Q |
56 |
cacaaattgccataagagaagttgaagcggtaagacaagagcttttagaagagcgtaaacatgttgaacgagttaaagagaatttcattagagaagttac |
155 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
18554696 |
cacaaattgccataagagaagttgaagtggtaagacaagagcttttagaagagcgtaaacatgtcgaacgagttaaagagaatttcattagagaagttac |
18554795 |
T |
 |
Q |
156 |
aattgttgaatcaagagctatttttgctgaggtaatttttggtctattaactattctacaagtttggtccaaatatctctattctctagtgcagatgaaa |
255 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18554796 |
atttgttgaatcaagagctatttttgctgaggtaatttttggtctattaactattctacaagtttggtccaaatatctctattctctagtgcagatgaaa |
18554895 |
T |
 |
Q |
256 |
attttcccaagtcttctaatttctgttcttgatttt |
291 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||| |
|
|
T |
18554896 |
attttcccaagtcttctaatttttgttcttgatttt |
18554931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University