View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0488_low_9 (Length: 297)
Name: NF0488_low_9
Description: NF0488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0488_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 2402930 - 2403171
Alignment:
| Q |
1 |
ttttaataacaaagttttaaacttttctttatttttatcgatggagtaggcttatgtgtgtgtatattgattgatgaagactggaatgtgaggcactgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2402930 |
ttttaataacaaagttttaaacttttcttgatttttatcgatggagtaggcttatgtgtgtatatattgattgatgaagactggaatgtgaggcactgtt |
2403029 |
T |
|
| Q |
101 |
atataatggttgtatgtggattgtttattgatgctatgaatgaactgtaatgttgaattgttccattaagcctcatgtagaattcaagatgataaattcc |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2403030 |
atataatggtcgtatgtggattgtttattgatgctatgaatgaactgtaatgttgaattgttccattaagcctcatgtagaattcaagatgataaattcc |
2403129 |
T |
|
| Q |
201 |
gtggaccattttattggaattgatatatgtagtttatctgtg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2403130 |
gtggaccattttattggaattgatatatgtagtttatctgtg |
2403171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 590 times since January 2019
Visitors: 3484