View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0489_high_10 (Length: 204)

Name: NF0489_high_10
Description: NF0489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0489_high_10
NF0489_high_10
[»] chr4 (1 HSPs)
chr4 (1-81)||(31150690-31150770)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 31150770 - 31150690
Alignment:
1 ttgacacataaatttagtaattgatcacgacgtcctcgagaaactatattaattaatcaaaagagagttttctaaatggaa 81  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31150770 ttgacacataaatttagtaattgatcacgacgtcctcgagaaactatattaattaatcaaaagagagttttctaaatggaa 31150690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University