View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0489_high_2 (Length: 284)
Name: NF0489_high_2
Description: NF0489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0489_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 22054653 - 22054380
Alignment:
| Q |
1 |
aagtcagaaatatgttgttgcagaaatttttctcaaactcttcaaaattcaattactaattatttgggtgtacatgcaattttatttactagtaagtacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
22054653 |
aagtcagaaatatgttgttgcagaaatttttctcaaactcttcaaaattcaattactaattatttgggtgtacatgcgattttattaactagtaagtacc |
22054554 |
T |
 |
| Q |
101 |
tcgggctaccatctagattaagacgaataagtcaggaacttttagctttatcaaagatcgaatttggaag-nnnnnnnttttaatttgtgtagtagtaag |
199 |
Q |
| |
|
|| |||||||||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
22054553 |
tcaagctaccatcttgattaagaggaataagtcgggaacttttagctttatcaaagatcgaatttggaagaaaaaaaaaattaatttgtgtagcagtaag |
22054454 |
T |
 |
| Q |
200 |
tgtttatctaaggtagaccgagaggtaatgatcaattttgtattgcaatcaattcctacttatgtatgagtata |
273 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22054453 |
tgttcatctaaggtagaccgagaggtaatgatcaattttgtattgcaatcaattcctacttatgtatgagtata |
22054380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University