View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0489_low_11 (Length: 205)
Name: NF0489_low_11
Description: NF0489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0489_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 31150746 - 31150872
Alignment:
| Q |
1 |
atcaattactaaatttatgtgtcaaagcaaagctttaaaatttgcacatgtaagtgcatcaataaggaagattacttacttataacgtacatcccatcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31150746 |
atcaattactaaatttatgtgtcaaagcaaagctttaaaatttgcacatgtaagtgcatcaataaggaagattacttacttataacgtacatcccatcca |
31150845 |
T |
 |
| Q |
101 |
gagagattggccacttgtgtctgtgct |
127 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
31150846 |
gagagattggccacttgtgtcagtgct |
31150872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 64 - 120
Target Start/End: Original strand, 31162086 - 31162140
Alignment:
| Q |
64 |
aaggaagattacttacttataacgtacatcccatccagagagattggccacttgtgt |
120 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| || |||||||||| |||||||| |
|
|
| T |
31162086 |
aaggaagattacttacttatgacgcacatcccaacc--agagattggcgacttgtgt |
31162140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 12781883 - 12781920
Alignment:
| Q |
28 |
caaagctttaaaatttgcacatgtaagtgcatcaataa |
65 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
12781883 |
caaagctttaaaatttgcacaagtaattgcatcaataa |
12781920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 104
Target Start/End: Original strand, 12781930 - 12781974
Alignment:
| Q |
60 |
caataaggaagattacttacttataacgtacatcccatccagaga |
104 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| |||||| ||||||| |
|
|
| T |
12781930 |
caataaggaagattgcttacttatcacgtagatcccagccagaga |
12781974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University