View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0489_low_7 (Length: 246)
Name: NF0489_low_7
Description: NF0489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0489_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 10071891 - 10071726
Alignment:
| Q |
1 |
tgtagctaaggtaataactaaagcaatgtcatttgtgcattatttgtcttatggtctcgttcatctgtgtagagaaaaatacatgcttatggagtctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
10071891 |
tgtagctaaggtaataactaaagcaatgtcatttgtgcattatttgtcttatggtctcgttcatctgtgtagaggaaaatacatgcttatggagcctttt |
10071792 |
T |
|
| Q |
101 |
acaagtttggcagagttcattcttaacatctatattttcaagttattccatgatttagttgtgttc |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10071791 |
acaagtttggcagagttcattcttaacatctatattttcaagttgttccatgatttagttgtgttc |
10071726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 25 times since January 2019
Visitors: 3463