View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0489_low_8 (Length: 233)
Name: NF0489_low_8
Description: NF0489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0489_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 47196339 - 47196243
Alignment:
Q |
1 |
cggaagagataagagaaggataagagaaacaaaacacatatccatccacatattaattagatacttgagtggatggataaaaagaatcacttgttat |
97 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47196339 |
cggaagagataagagaaggataagagaaacaaaacacatatccatccacatattaattagatacttgagtggatggataaaaagaatcacttgttat |
47196243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University