View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493-Insertion-16 (Length: 330)
Name: NF0493-Insertion-16
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493-Insertion-16 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
| [»] scaffold0361 (2 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 58 - 330
Target Start/End: Complemental strand, 4945964 - 4945693
Alignment:
| Q |
58 |
gtggcttccatttcctggcattacttcgagtttccccgttgtggctgccatacaagtggtaaatcacgtctttcgcagctgcaactttgatggcaatcga |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4945964 |
gtggcttccatttcctggcattacttcgagtttccc-gttgtggctgccatacaagtggtaaatcacgtcttttgcagctgcaactttgatggcaatcga |
4945866 |
T |
|
| Q |
158 |
aaactgtccttttacccatctcatcataatcttactgattagtaagaagcatagagaaagttagaaacccttagtcagtctctcatgttcaccgcattgt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4945865 |
aaactgtccttttacccatctcatcataatcttactgattagtaagaaacatagagaaagttagaaacccttagtcagtctctcatgttcaccgcattgt |
4945766 |
T |
|
| Q |
258 |
tcttcccaagccctgtggtttccgggcataacatgccacgcctgcacccgcaccctattctccacatgctcgg |
330 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4945765 |
tctgcccaagccctgtggtttccgggcataacatgccacacctgcacccgcaccctattctccacatgctcgg |
4945693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 4946680 - 4946621
Alignment:
| Q |
8 |
aaaacatgattgttattcgcatgcttgcatggggaaacacatcatgaatagtggcttcca |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4946680 |
aaaacatgattgttattcgcatgcttgcatgggtaaacacatcatgaatagtggcttcca |
4946621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0361 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: scaffold0361
Description:
Target: scaffold0361; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 8 - 201
Target Start/End: Complemental strand, 11350 - 11159
Alignment:
| Q |
8 |
aaaacatgattgttattcgcatgcttgcatggggaaacacatcatgaatagtggcttccatttcctggcattacttcgagtttccccgttgtggctgcca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11350 |
aaaacatgattgttattcgcatgcttgcatggggaaacacatcatgaatagtggcttccatttcctggcattacttcgagtttccccgttgtggctgcca |
11251 |
T |
|
| Q |
108 |
tacaagtggtaaatcacgtctttcgcagctgcaactttgatggcaatcgaaaactgtccttttacccatctcatcataatcttactgattagta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
11250 |
tacaagtggtaaatcacgtctttcgcagctgcaactttgagggcaatcgaaaactgtcctttt-cccatctcatcataatc-tactgattagta |
11159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0361; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 243 - 316
Target Start/End: Complemental strand, 11041 - 10968
Alignment:
| Q |
243 |
tgttcaccgcattgttcttcccaagccctgtggtttccgggcataacatgccacgcctgcacccgcaccctatt |
316 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||| |||||||| || | ||||||||||| ||||||| |
|
|
| T |
11041 |
tgttcaccgcattgttctgcccaaaccctgtggtttccggacataacataccgcacctgcacccgcgccctatt |
10968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1725 times since January 2019
Visitors: 3461