View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493-Insertion-19 (Length: 306)
Name: NF0493-Insertion-19
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493-Insertion-19 |
 | |
|
| [»] scaffold0318 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0318 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: scaffold0318
Description:
Target: scaffold0318; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 10 - 277
Target Start/End: Original strand, 14887 - 15151
Alignment:
| Q |
10 |
aaggaaattgaagctaagtttagaaaaatggaacgttacgtgatgcttacggcaactttacaccgtgaaatggaagagctttctgttttggaaaatgggt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14887 |
aaggaaattgaagctaagtttagaaaaatggaacgttacgtgatgcttacggcaactttacaccgtgaaatggaagagctttctgttttagaaaatgggt |
14986 |
T |
|
| Q |
110 |
ttagaaaagctttgaatttgaatcatcaccatcatcatcgtaggaatagttgtagtgaaggaaatgaaggttctttgggcgttggaaaagaagagaaaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||| ||||||| |
|
|
| T |
14987 |
ttagaaaagctttgaatttgaatcat---catcatcatcgtaggaatagttgtagtgaaggaaatgaaagttcttttggtgttggaaaagagcagaaaat |
15083 |
T |
|
| Q |
210 |
ttatgaacttcagcaaaagatttgttggcagaaaccagaagtggaggatatgaaagattggtgtttgt |
277 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||| ||||| |||||||| ||||||||| |
|
|
| T |
15084 |
ttatgaacttcagcagaagatttgttggcagaaacaagaagttaaggatctgaaagataggtgtttgt |
15151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1721 times since January 2019
Visitors: 3461