View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493-Insertion-22 (Length: 203)
Name: NF0493-Insertion-22
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493-Insertion-22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 8e-97; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 8 - 202
Target Start/End: Complemental strand, 32255573 - 32255379
Alignment:
| Q |
8 |
tattgttggtcttagtttaggggaaagtttttgaagctcacggaacagaattttaatgtcaagtgtgaggcgcccaactagtgcccatgaaaaccccgcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32255573 |
tattgttggtcttagtttaggggaaagtttgtgaagctcacggaacagaatttttatgtcaagtgtgaggcacccaactagtgcccatgaaaaccccgcc |
32255474 |
T |
|
| Q |
108 |
ctaatgaccgcatgtagcattgcaacgtgttgagcccctggtgacatttgataagccagaacaatccaaccgtagcaccgcaacatccacgacgg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32255473 |
ctaatgaccgcatgtagcattgcaatgtgttgagcccctggtgacatttgataagccagaacaatccaaccgtagcaccgcaacatccacgacgg |
32255379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 11 - 182
Target Start/End: Complemental strand, 32264633 - 32264462
Alignment:
| Q |
11 |
tgttggtcttagtttaggggaaagtttttgaagctcacggaacagaattttaatgtcaagtgtgaggcgcccaactagtgcccatgaaaaccccgcccta |
110 |
Q |
| |
|
|||||||||||||||| |||||| ||| || ||||||||||||| ||||||||||| ||| ||||||| |||||||||| |||||||||| |||||| |
|
|
| T |
32264633 |
tgttggtcttagtttaagggaaaatttgtgtagctcacggaacacaattttaatgttaagcacgaggcgctcaactagtgcgcatgaaaacctcgccctg |
32264534 |
T |
|
| Q |
111 |
atgaccgcatgtagcattgcaacgtgttgagcccctggtgacatttgataagccagaacaatccaaccgtag |
182 |
Q |
| |
|
||||| ||| | |||| | || |||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
32264533 |
atgactgcacggagcactataatgtgttgagccccgagaaacatttgataagccagaacaatccaaccgtag |
32264462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 194
Target Start/End: Complemental strand, 32249601 - 32249563
Alignment:
| Q |
156 |
tgataagccagaacaatccaaccgtagcaccgcaacatc |
194 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
32249601 |
tgataagccagaacaatccaatcatagcaccgcaacatc |
32249563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 22 - 165
Target Start/End: Complemental strand, 23203297 - 23203147
Alignment:
| Q |
22 |
gtttaggggaaagtttttgaagctcacggaacagaattttaatgtcaagtgtgaggcgcccaactagtgccca-tgaaaaccccgccc------taatga |
114 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||| | || |||| ||||||||| || ||||||| |||||| |||||| |
|
|
| T |
23203297 |
gtttaggggaaagtttgtgaagctcacggaacatgtttttaatgtcaagcgcgaagcgctaaactagtgcgcattgaaaactccgccctaatattaatga |
23203198 |
T |
|
| Q |
115 |
ccgcatgtagcattgcaacgtgttgagcccctggtgacatttgataagcca |
165 |
Q |
| |
|
||||| | |||| || || |||||||||||| | ||||||||||||||||| |
|
|
| T |
23203197 |
ccgcacggagcactgtaatgtgttgagccccagttgacatttgataagcca |
23203147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1727 times since January 2019
Visitors: 3461