View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493-Insertion-23 (Length: 184)
Name: NF0493-Insertion-23
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493-Insertion-23 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 8 - 184
Target Start/End: Complemental strand, 2212326 - 2212150
Alignment:
Q |
8 |
tcaagagaagaaaaaattgttgaggattaggattggtgtgtacctttgtaacctcttgttcagtagagtaatcaacttcaacaacttcatggataattga |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
T |
2212326 |
tcaagagaagaaaaaattgttgaggattaggattggtgtgtacctttgtaacctcttgttcagtagagcaatcaacttcaacaacttcatgaataattga |
2212227 |
T |
 |
Q |
108 |
agtaactcttttctcttcaatctctgaactgctaggactcgacatttttgacatagtctctcttattattttctcaa |
184 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
2212226 |
agtaactcttttctcttcaatctctgaactgctaggactcgacatttttgacataatctctcttattattttctcaa |
2212150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University