View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493-Insertion-24 (Length: 172)
Name: NF0493-Insertion-24
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493-Insertion-24 |
 |  |
|
[»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 5e-79; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 5e-79
Query Start/End: Original strand, 8 - 172
Target Start/End: Complemental strand, 380377 - 380213
Alignment:
Q |
8 |
atttgttgctaggaaagaaatacaaaaatgatgaccaagcttgcctcttttagcgtttgtgctcacgttcatcattgaagcttcttccacgcttgctgcc |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
380377 |
atttgttgctaggaaagaaatacaaaaatgatgaccaaccttacctcttttagcatttgtgatcacgttcatcattgaagcttcttccacgcttgctgcc |
380278 |
T |
 |
Q |
108 |
aaccgcatcaagttcatcaatgaatatgattgacggtgaaatttccttgctgtactgaacaggtc |
172 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
380277 |
aaccgcatcaagttcatcaatgaatatgattgacggtgaaatttccttgctgtactgaacaggtc |
380213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 85; E-Value: 9e-41
Query Start/End: Original strand, 10 - 172
Target Start/End: Complemental strand, 6300354 - 6300194
Alignment:
Q |
10 |
ttgttgctaggaaagaaatacaaaaatgatgaccaagcttgcctcttttagcgtttgtgctcacgttcatcattgaagcttcttccacgcttgctgccaa |
109 |
Q |
|
|
|||||||||| |||||||||||||| ||||||| || ||||||| ||||||||||| || ||||| |||||||||| |||||||||||||| |||| |
|
|
T |
6300354 |
ttgttgctagaaaagaaatacaaaa-tgatgactaaacttgcctgatttagcgtttgg--tcccgttcctcattgaagcctcttccacgcttgccaccaa |
6300258 |
T |
 |
Q |
110 |
ccgcatcaagttcatcaatgaatatgattgacggtg-aaatttccttgctgtactgaacaggtc |
172 |
Q |
|
|
||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
T |
6300257 |
ccgcatcaagttcatcaatgaatatgattgatggtgcaaatttccttgctctactgaacaggtc |
6300194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 85; E-Value: 9e-41
Query Start/End: Original strand, 10 - 172
Target Start/End: Complemental strand, 6307164 - 6307004
Alignment:
Q |
10 |
ttgttgctaggaaagaaatacaaaaatgatgaccaagcttgcctcttttagcgtttgtgctcacgttcatcattgaagcttcttccacgcttgctgccaa |
109 |
Q |
|
|
|||||||||| |||||||||||||| ||||||| || ||||||| ||||||||||| || ||||| |||||||||| |||||||||||||| |||| |
|
|
T |
6307164 |
ttgttgctagaaaagaaatacaaaa-tgatgactaaacttgcctgatttagcgtttgg--tcccgttcctcattgaagcctcttccacgcttgccaccaa |
6307068 |
T |
 |
Q |
110 |
ccgcatcaagttcatcaatgaatatgattgacggtg-aaatttccttgctgtactgaacaggtc |
172 |
Q |
|
|
||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
T |
6307067 |
ccgcatcaagttcatcaatgaatatgattgatggtgcaaatttccttgctctactgaacaggtc |
6307004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University