View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493-Insertion-31 (Length: 110)
Name: NF0493-Insertion-31
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493-Insertion-31 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 3e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 3e-33
Query Start/End: Original strand, 6 - 110
Target Start/End: Complemental strand, 8933906 - 8933803
Alignment:
Q |
6 |
cactgttgccattttttatactgnnnnnnnncaaatattcctctagaattagatttcaagtttcaacctcacacttgtgaaattattgtgtataactata |
105 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
8933906 |
cactgttgccattttttatactgaaaaaaa-caaatattcctctagaattagatttcaagtttcaacctcacacttgtgaaattattatgtataactata |
8933808 |
T |
 |
Q |
106 |
aagta |
110 |
Q |
|
|
||||| |
|
|
T |
8933807 |
aagta |
8933803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University