View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_high_10 (Length: 319)
Name: NF0493_1D_high_10
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_1D_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 264 - 311
Target Start/End: Complemental strand, 42480012 - 42479965
Alignment:
| Q |
264 |
atcttgcgtctattggcttgttacaatatcctcacaggttctgctcgt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
42480012 |
atcttgcgtctattggcttgttacaatatcctcacttgttctgttcgt |
42479965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 653 times since January 2019
Visitors: 3486