View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0493_1D_high_10 (Length: 319)

Name: NF0493_1D_high_10
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0493_1D_high_10
NF0493_1D_high_10
[»] chr3 (1 HSPs)
chr3 (264-311)||(42479965-42480012)


Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 264 - 311
Target Start/End: Complemental strand, 42480012 - 42479965
Alignment:
264 atcttgcgtctattggcttgttacaatatcctcacaggttctgctcgt 311  Q
    |||||||||||||||||||||||||||||||||||  |||||| ||||    
42480012 atcttgcgtctattggcttgttacaatatcctcacttgttctgttcgt 42479965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University