View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_high_11 (Length: 310)
Name: NF0493_1D_high_11
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_1D_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 90 - 276
Target Start/End: Complemental strand, 31929512 - 31929326
Alignment:
| Q |
90 |
agtttaagagttaacaaattcactacgattccagcccaataaacatgttttcattttcgagttaacttaattggactttatagtcgagtcaactcaaaat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| || | ||| | || |||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31929512 |
agtttaagagttaacaaattcactacgagtccatccgagtaagcttggtttcattttcaagttaacttaattggagtttatagtcgagtcaactcaaaat |
31929413 |
T |
 |
| Q |
190 |
tgatacctaaacatacgatcctacgagttaactcgtgattttaactacctttatcaaaacataacaagattgtcaaactcctactct |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31929412 |
tgatacctaaacatacgatcctacgagttaactcgtgattttaacaacctttatcaaaacataacaagattgtcaaactccaactct |
31929326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University