View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_high_18 (Length: 242)
Name: NF0493_1D_high_18
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_1D_high_18 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 3 - 242
Target Start/End: Original strand, 7432907 - 7433146
Alignment:
Q |
3 |
gaccaacgagattattagattagattataggtttctttttaagtggatagttggcctctcagccgataacttgtcatcatgtctcaaccaaggtagcaca |
102 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7432907 |
gaccaacgagattattagattagattataggtttctttttaagtggatagttggcctctcagccgataacttgtcatcatgtctcaaccaaggtagcaca |
7433006 |
T |
 |
Q |
103 |
tatactttacgtacccaacgtcttttcttaccttttccctttctttcttcaatacaaagaaaattacaaaatatatgtgaagctttttaatttgattaat |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
7433007 |
tatactttacgtacccaacgtcttttcttaccttttccctttctttcttcaatacaaagaaaatgacaaaatatatgtgaagctttttaatttgattaat |
7433106 |
T |
 |
Q |
203 |
tgcactccctctattttaactcgacttttattgataaaga |
242 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7433107 |
tgcactccctctattttaactcgacttttattgataaaga |
7433146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 765 times since January 2019
Visitors: 3491