View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_high_19 (Length: 231)
Name: NF0493_1D_high_19
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_1D_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 95 - 222
Target Start/End: Complemental strand, 5218457 - 5218330
Alignment:
Q |
95 |
ttttgctcttgtggcacatagttcctgtgaacgtaaatatacatcttctgtttaatttcatataattgaattagttacttcatatgattaaaacaataga |
194 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5218457 |
ttttgctcttgtggcacatagttcctgtgaaagtaaatatacatcttctgtttaatttcatataattgaattagttacttcatatgattaaaacaataga |
5218358 |
T |
 |
Q |
195 |
gaaacacaccaaacacgaaatcaacacc |
222 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
5218357 |
gaaacacaccaaacacgaaatcaacacc |
5218330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 105 - 199
Target Start/End: Complemental strand, 5218171 - 5218082
Alignment:
Q |
105 |
gtggcacatagttcctgtgaacgtaaatatacatcttctgtttaatttcatataattgaattagttacttcatatgattaaaacaatagagaaac |
199 |
Q |
|
|
|||||||||||||||| ||||| |||||| | ||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
T |
5218171 |
gtggcacatagttcctatgaacataaataca-----tctatttaatttcatataattgaattagttacttcatatgattgaaacaattgagaaac |
5218082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University