View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_high_21 (Length: 217)
Name: NF0493_1D_high_21
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_1D_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 6001579 - 6001385
Alignment:
Q |
1 |
ctctctaagtttgaggccctctgttaaggatctttttacccacttacacatgactgaccctgacacagattccaacagttggatacctacctcagtgtaa |
100 |
Q |
|
|
|||||||||||||||||| | ||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
6001579 |
ctctctaagtttgaggccatatgttaaggatcttcttacccacttgcacatgactgaccctgacacaggttccaacagttggatacctacctcagtgtag |
6001480 |
T |
 |
Q |
101 |
taagactgattactttcttaaccatcaaaatatttcttgttttatgtttcattaagatattttccaattttgtttgctttttgttatgttgcact |
195 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6001479 |
taagactgattactttcttaaccatcaaaatatttcttgttttatgtttcattaagatattttccaattttgtttgctttttgttatgttgcact |
6001385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University