View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_low_16 (Length: 286)
Name: NF0493_1D_low_16
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_1D_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 25 - 250
Target Start/End: Complemental strand, 8293773 - 8293547
Alignment:
Q |
25 |
ctaactattaacatactaatattctacatttgttattnnnnnnntagcacctaaaccagagatgcaattaattatatggagatcaaatgcacatgacacg |
124 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8293773 |
ctaactattaacatactaatattctacatttgttattaaaaaaatagcacctaaaccagagatgcaattaattatatggagatcaaatgcacatgacacg |
8293674 |
T |
 |
Q |
125 |
gacgctatacaaaacgcagcaacaaaatatctggaatcagagaaattaacacggaagagaagaga-aaaataaatggacacataagatttaccagtttca |
223 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
8293673 |
gacgctatacaaaacgcagcaacaaaatatctggaatcagagaaattaacacggaagagaagagaaaaaataaatggacacataagatttaccagtttca |
8293574 |
T |
 |
Q |
224 |
atcaattgtaagcagctccacaggttc |
250 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
8293573 |
gtcaattgtaagcagctccacaggttc |
8293547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 586 times since January 2019
Visitors: 3484