View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_low_20 (Length: 258)
Name: NF0493_1D_low_20
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_1D_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 9 - 252
Target Start/End: Original strand, 52972394 - 52972637
Alignment:
| Q |
9 |
ggtgttgcagtgccttaacccagatggccttcatcaacaagggaacaaggtgtctaagcaggttttgagagagaggtttaagtgtttcaattccatgttt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52972394 |
ggtgttgcagtgccttaacccagatggccttcatcaacaagggaacaaggtctctaagcaggttttgagagagaggtttaagtgtttcaattccatgttt |
52972493 |
T |
 |
| Q |
109 |
gaagatatccacaagacgcaaagtagttggatggtgagcgatgaacaacttcaatcagagttaagagtttcaatatctgccttggtcatacctgcgtatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52972494 |
gaagatatccacaagacgcaaagtagttggatggtgagcgatgaacaacttcaatcagagttaagagtttcaatatctgccttggtcatacctgcgtatc |
52972593 |
T |
 |
| Q |
209 |
gctcctttatgggaagatttaaacatcatctagaaacaggaaga |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52972594 |
gctcctttatgggaagatttaaacatcatctagaaacaggaaga |
52972637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University