View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_low_21 (Length: 256)
Name: NF0493_1D_low_21
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_1D_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 49 - 255
Target Start/End: Original strand, 23332595 - 23332801
Alignment:
Q |
49 |
atatgtggacgaatgagcgatagaagcgcatgaccgatccaccctcacgttggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
148 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23332595 |
atatatggacgaatgagcgatagaagcgcatgaccgatccaccctcacgtgggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
23332694 |
T |
 |
Q |
149 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacataagtcagggtgacccacgcaccacgatctaccttatagaaacccctc |
248 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
23332695 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacatacgtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
23332794 |
T |
 |
Q |
249 |
agctcag |
255 |
Q |
|
|
||||||| |
|
|
T |
23332795 |
agctcag |
23332801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 12 - 54
Target Start/End: Original strand, 23322331 - 23322373
Alignment:
Q |
12 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
54 |
Q |
|
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
T |
23322331 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23322373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 12 - 54
Target Start/End: Original strand, 23332498 - 23332540
Alignment:
Q |
12 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
54 |
Q |
|
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
T |
23332498 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23332540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University