View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0493_1D_low_27 (Length: 244)

Name: NF0493_1D_low_27
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0493_1D_low_27
NF0493_1D_low_27
[»] chr2 (2 HSPs)
chr2 (22-201)||(31929637-31929827)
chr2 (22-114)||(31924084-31924176)


Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 22 - 201
Target Start/End: Complemental strand, 31929827 - 31929637
Alignment:
22 caagatagaggtaaaatgtggaggtcttcttattccaatttacaacacagtggtggggaaggtcgcgtggccctggctggaagccatcaaaaccaaggtt 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31929827 caagatagaggtaaaatgtggaggtcttcttattccaatttacaacacagtggtggggaaggtcgcgtggccctggctggaagccatcaaaaccaaggtt 31929728  T
122 gtcaaaatcgatagtttaagtaaactcaatttgcctacgtgaaattaa-----------gtatgagtttacctaatattaaaataatatat 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||||||||||||||    
31929727 gtcaaaatcgatagtttaagtaaactcaatttgcctacgtgaaattaactcgtagacttgtatgagtttacctaatattaaaataatatat 31929637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 22 - 114
Target Start/End: Complemental strand, 31924176 - 31924084
Alignment:
22 caagatagaggtaaaatgtggaggtcttcttattccaatttacaacacagtggtggggaaggtcgcgtggccctggctggaagccatcaaaac 114  Q
    |||||||||||||||||||||| ||||||||| |||  |||| || ||| || |||||||| || ||||| |||||||| ||| |||||||||    
31924176 caagatagaggtaaaatgtggaagtcttcttactccgctttataagacaatgatggggaagatcacgtggtcctggctgtaagtcatcaaaac 31924084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University