View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_low_27 (Length: 244)
Name: NF0493_1D_low_27
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_1D_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 22 - 201
Target Start/End: Complemental strand, 31929827 - 31929637
Alignment:
Q |
22 |
caagatagaggtaaaatgtggaggtcttcttattccaatttacaacacagtggtggggaaggtcgcgtggccctggctggaagccatcaaaaccaaggtt |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31929827 |
caagatagaggtaaaatgtggaggtcttcttattccaatttacaacacagtggtggggaaggtcgcgtggccctggctggaagccatcaaaaccaaggtt |
31929728 |
T |
 |
Q |
122 |
gtcaaaatcgatagtttaagtaaactcaatttgcctacgtgaaattaa-----------gtatgagtttacctaatattaaaataatatat |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
31929727 |
gtcaaaatcgatagtttaagtaaactcaatttgcctacgtgaaattaactcgtagacttgtatgagtttacctaatattaaaataatatat |
31929637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 22 - 114
Target Start/End: Complemental strand, 31924176 - 31924084
Alignment:
Q |
22 |
caagatagaggtaaaatgtggaggtcttcttattccaatttacaacacagtggtggggaaggtcgcgtggccctggctggaagccatcaaaac |
114 |
Q |
|
|
|||||||||||||||||||||| ||||||||| ||| |||| || ||| || |||||||| || ||||| |||||||| ||| ||||||||| |
|
|
T |
31924176 |
caagatagaggtaaaatgtggaagtcttcttactccgctttataagacaatgatggggaagatcacgtggtcctggctgtaagtcatcaaaac |
31924084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University