View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_low_29 (Length: 240)
Name: NF0493_1D_low_29
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_1D_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 3 - 234
Target Start/End: Original strand, 31750187 - 31750418
Alignment:
| Q |
3 |
caaacccgctttgtctcatcgtcaatttgtcatgcctatgtatttatggtgtatcatattgttcataaacaaactcataaatatgacgagttagagatta |
102 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31750187 |
caaacccgcttcgtctcattgtcaatttgtcatgcctatgtgtttatggtgtatcatattgttcataaacaaactcataaatatgacgagttagagatta |
31750286 |
T |
|
| Q |
103 |
ctatgagnnnnnnnnnccttggagaaatttaattagaaaagataaatatttcaattattttaagggtaaaaataaatatttcatgttttagtagaaaact |
202 |
Q |
| |
|
||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31750287 |
ctaagagtttttttttccttggagaaatttaattagaaaaaataaatatttcaattattttaagggtaaaaataaatatttcattttttagtagaaaact |
31750386 |
T |
|
| Q |
203 |
gaatggtttatctcaatgtgtgatgttcatat |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31750387 |
aaatggtttatctcaatgtgtgatgttcatat |
31750418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 482 times since January 2019
Visitors: 3478