View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_low_32 (Length: 235)
Name: NF0493_1D_low_32
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_1D_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 28547982 - 28547786
Alignment:
| Q |
1 |
cgtaacaattgctgccatttcaatgattgagatgcttttcatagagatgacatgtactatatcgcggtgtcatgacaactgttgcaattattgactgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28547982 |
cgtaacaattgctgccatttcaatgattgagatgcttttcatagagatgacatgtactatatcgcggtgtcatgacaactgttgca-------------t |
28547896 |
T |
 |
| Q |
101 |
cggtgataacacatagatctgtggacgtatcatcatagaccgtctaacattgaatctcattgtttaataagccaactgcaattccattttagcaggcttc |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28547895 |
cggtgataacgcatagatctgtggacgtatcatcataaaccgtctaacattaaatctcattgtttaataagccaactgcaattccattttagcaggcttc |
28547796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 41868428 - 41868624
Alignment:
| Q |
1 |
cgtaacaattgctgccatttcaatgattgagatgcttttcatagagatgacatgtactatatcgcggtgtcatgacaactgttgcaattattgactgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41868428 |
cgtaacaattgctgccatttcaatgattgagatgcttttcatagagatgacatgtactatatcgcggtgtcatgacaactgttgca-------------t |
41868514 |
T |
 |
| Q |
101 |
cggtgataacacatagatctgtggacgtatcatcatagaccgtctaacattgaatctcattgtttaataagccaactgcaattccattttagcaggcttc |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41868515 |
cggtgataacgcatagatctgtggacgtatcatcataaaccgtctaacattaaatctcattgtttaataagccaactgcaattccattttagcaggcttc |
41868614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 34705219 - 34705415
Alignment:
| Q |
1 |
cgtaacaattgctgccatttcaatgattgagatgcttttcatagagatgacatgtactatatcgcggtgtcatgacaactgttgcaattattgactgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34705219 |
cgtaacaattgctgccatttcaatgattgagatgcttttcatagagatgacatgtactatatcgcggtgtcatgacaactgttgca-------------t |
34705305 |
T |
 |
| Q |
101 |
cggtgataacacatagatctgtggacgtatcatcatagaccgtctaacattgaatctcattgtttaataagccaactgcaattccattttagcaggcttc |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34705306 |
cggtgataacgcatagatctgtggacgtatcatcatattccgtctaacattaaatctcattgtttaataagccaactgcaattccattttagcaggcttc |
34705405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University