View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_low_35 (Length: 230)
Name: NF0493_1D_low_35
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_1D_low_35 |
 | |
|
| [»] scaffold0003 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 24494896 - 24494684
Alignment:
| Q |
1 |
gagaagtgatgacaaccagagaacttctgcagatgcggatgctagagctctatattcagcttcagtggatgatcttgcaacggctttttgtttaaaggac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24494896 |
gagaagtgatgacaaccagagaacttctgcagatgcggatgctagagctctatattcagcttcagtggatgatcttgcaacggctttttgtttaaaagac |
24494797 |
T |
|
| Q |
101 |
ttccaagaaattgggttaccaccataaaatgtaacatgtgcagaggtggatgtataatcatctctatttccagcccaatccgcatcactgaatgcataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24494796 |
ttccaagaaattgggttaccaccataaaatgtaacatgtgcagaggtggatgtataatcatctctatttccagcccaatcggcatcactgaatgcataaa |
24494697 |
T |
|
| Q |
201 |
gattttgagaaga |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24494696 |
gattttgagaaga |
24494684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 86361 - 86237
Alignment:
| Q |
1 |
gagaagtgatgacaaccagagaacttctgcagatgcggatgctagagctctatattcagcttcagtggatgatcttgcaacggctttttgtttaaaggac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
86361 |
gagaagtgatgacaaccagagaacttctgcggatgcgtatgctagagctctgtattcagcttcagtggatgatcttgcaacaaatttttgtttaaaagac |
86262 |
T |
|
| Q |
101 |
ttccaagaaattgggttaccaccat |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
86261 |
ttccaagaaattgggttaccaccat |
86237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 121 - 213
Target Start/End: Complemental strand, 94126 - 94034
Alignment:
| Q |
121 |
accataaaatgtaacatgtgcagaggtggatgtataatcatctctatttccagcccaatccgcatcactgaatgcataaagattttgagaaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
94126 |
accataaaatgtaacatgtgcagaggtggatgtataatcatctcgatttccagcccaatcggcatcactgaatgcatatagattttgagaaga |
94034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 18557096 - 18557131
Alignment:
| Q |
1 |
gagaagtgatgacaaccagagaacttctgcagatgc |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18557096 |
gagaagtgatgacaaccagagaacttctgcggatgc |
18557131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 701 times since January 2019
Visitors: 3489