View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_low_37 (Length: 228)
Name: NF0493_1D_low_37
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_1D_low_37 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 228
Target Start/End: Original strand, 35621587 - 35621800
Alignment:
Q |
15 |
cagaacccacatgttagtcaaatccatttcactcttcactccactttcgcattctcttcaggttagttaccctctatttcaatttatattcttcttcgct |
114 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
35621587 |
cagaacccacatgttagtcaaatccatttcactcttcactccattttcgcattctcttcaggttagttaccctccatttcaatttatattcttcttcgct |
35621686 |
T |
 |
Q |
115 |
tgaattgttctgctgtgttccatttttgcataattttatgaagtgggcatggattgaattgtgtttagagtcttttgagcatgtaaaggttataacttta |
214 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35621687 |
tgaattgttctgctgtgttccatttttgcataattttatgaagtgggcatggattgaattgtgtttagagtcttttgagcatgtaaaggttataacttta |
35621786 |
T |
 |
Q |
215 |
ttttcatagttcat |
228 |
Q |
|
|
|||||||||||||| |
|
|
T |
35621787 |
ttttcatagttcat |
35621800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University