View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_low_39 (Length: 223)
Name: NF0493_1D_low_39
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_1D_low_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 61 - 138
Target Start/End: Original strand, 288356 - 288433
Alignment:
Q |
61 |
cccaaatgtattatcctcttatctcgtttgttagtgtactctatttatagaattttcatgttaatgtagatatggaag |
138 |
Q |
|
|
|||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
288356 |
cccaaatgtattctcctcttatcttctgtgttagtgtactctatttatagaattttcatgttaatgtggatatggaag |
288433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University