View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0493_1D_low_39 (Length: 223)

Name: NF0493_1D_low_39
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0493_1D_low_39
NF0493_1D_low_39
[»] chr6 (1 HSPs)
chr6 (61-138)||(288356-288433)


Alignment Details
Target: chr6 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 61 - 138
Target Start/End: Original strand, 288356 - 288433
Alignment:
61 cccaaatgtattatcctcttatctcgtttgttagtgtactctatttatagaattttcatgttaatgtagatatggaag 138  Q
    |||||||||||| |||||||||||  | ||||||||||||||||||||||||||||||||||||||| ||||||||||    
288356 cccaaatgtattctcctcttatcttctgtgttagtgtactctatttatagaattttcatgttaatgtggatatggaag 288433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University