View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_low_41 (Length: 218)
Name: NF0493_1D_low_41
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_1D_low_41 |
 |  |
|
[»] scaffold0212 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0212 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: scaffold0212
Description:
Target: scaffold0212; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 15 - 206
Target Start/End: Complemental strand, 14036 - 13845
Alignment:
Q |
15 |
tggacatcaatggtatcggacttatgagtattcagactataacagttccgatgaacagtcactcacttttgacagttatacgattccggaagatgatcta |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14036 |
tggacatcaatggtatcggacttatgagtattcagactataacagttccgatgaacagtcactcacttttgacagttatacgattccggaagatgatcta |
13937 |
T |
 |
Q |
115 |
gaattgggtcaatcacgtttattagaagtggacaatagagtggttgtaccagccaaaactcatctacgtattattgtaacatctgctgatgt |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13936 |
gaattgggtcaatcacgtttattagaagtggacaatagagtggttgtaccagccaaaactcatctacgtattattgtaacatctgctgatgt |
13845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 73 - 206
Target Start/End: Original strand, 1677528 - 1677661
Alignment:
Q |
73 |
tcactcacttttgacagttatacgattccggaagatgatctagaattgggtcaatcacgtttattagaagtggacaatagagtggttgtaccagccaaaa |
172 |
Q |
|
|
|||||||||||||| | |||||||||| |||| |||||||| |||| ||||||||| ||||||||||| |||||||||||||| ||||||||||||||| |
|
|
T |
1677528 |
tcactcacttttgaaacttatacgattttggaaaatgatctataattaggtcaatcatgtttattagaattggacaatagagtgattgtaccagccaaaa |
1677627 |
T |
 |
Q |
173 |
ctcatctacgtattattgtaacatctgctgatgt |
206 |
Q |
|
|
|||||||||||||||||||||||| || |||||| |
|
|
T |
1677628 |
ctcatctacgtattattgtaacatttgttgatgt |
1677661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 15 - 61
Target Start/End: Complemental strand, 34584489 - 34584443
Alignment:
Q |
15 |
tggacatcaatggtatcggacttatgagtattcagactataacagtt |
61 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34584489 |
tggacatcaatggtatcggacttatgagtattcagactataacagtt |
34584443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University