View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_1D_low_44 (Length: 210)
Name: NF0493_1D_low_44
Description: NF0493_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_1D_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 5 - 205
Target Start/End: Complemental strand, 32261503 - 32261303
Alignment:
| Q |
5 |
tgagatgaatcacaaagacacataagggactttcttgaattgggttgcaaatttccactagggcagtcatgccacgaacgtttccttcactatgtaaaca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32261503 |
tgagatgaatcacaaagacacataagggactttcttgaattgggttgcaaatttccactagggcagtcatgccacgaacgtttccttcactatgtaaaca |
32261404 |
T |
|
| Q |
105 |
agtaacaatgcgaaactctgaatttcttggagtgttttggattgctctcatttcttcatcaaatatgcttgatgaacttaagactcgaggacgatgcttg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32261403 |
agtaacaatgcgaaactctgaatttcttggagtgttttggattgttctcatttcttcatcaaatatgcttgatgaacttaatactcgaggacgatgcttg |
32261304 |
T |
|
| Q |
205 |
t |
205 |
Q |
| |
|
| |
|
|
| T |
32261303 |
t |
32261303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 641 times since January 2019
Visitors: 3486