View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_2D_high_2 (Length: 467)
Name: NF0493_2D_high_2
Description: NF0493_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_2D_high_2 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 425; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 425; E-Value: 0
Query Start/End: Original strand, 19 - 467
Target Start/End: Complemental strand, 22359965 - 22359517
Alignment:
Q |
19 |
atgaagcacaaacagttaattagttgggatttcagtttacctaccttagctttgaagtaaaggctgacagtgccacgtcatcactcaccgccggccggag |
118 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22359965 |
atgaagcacaaacagttaattagttgggatttcagtttaactaccttagctttgaagtaaaggctgacagtgccacgtcatcactcaccgccggccggag |
22359866 |
T |
 |
Q |
119 |
agggctcagctcctcggaactcaacaccgacgaagaattcgactttgattttgctttcgattgtgatcctgaccgttctctcgatctccgatcatcatcg |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
T |
22359865 |
agggctcagctcctcggaactcaacaccgacgaagaattcgactttgattttgctttcgattgtgaccccgaccgttctctcgatctccgatcatcatcg |
22359766 |
T |
 |
Q |
219 |
gaaccaaaaatatctccataaaacgcatcattcttcgccggaatcctgaacaccggcaagttccggccactttttgccggcgccggagacacaaacgccg |
318 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22359765 |
gaaccaaaaatatctccataaaacgcatcattcttcgccggaatcctgaacaccggcaagttccggccactttttgccggcgccggagacacaaacgccg |
22359666 |
T |
 |
Q |
319 |
gctgtttgaaaatttcttcgtagaaagaaccggtcctggagaatttgtgagtgaggaggcttctaggtggacctccgaagacgtcggcgaagtcgtcggg |
418 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22359665 |
gctgtttgaaaatttcttcgtagaaagaaccggtcctggagaatttatgcgtgaggagacttctaggtggacctccgaagacgtcggcgaagtcgtcggg |
22359566 |
T |
 |
Q |
419 |
gtctaaggtttccgttacggagaggttggtgttggagaagatggactgc |
467 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22359565 |
gtctaaggtttccgttacggagaggttggtgttggagaagatggactgc |
22359517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 106 - 412
Target Start/End: Original strand, 54306979 - 54307273
Alignment:
Q |
106 |
ccgccggccggagagggctcagctcctcggaactcaacaccgacgaagaattcgactttgattttgctttcgattgtgatcctgaccgttctctcgatct |
205 |
Q |
|
|
|||| ||||||||| |||||||||||| | | |||| | |||| || |||||| |||| ||||||||||| || || || ||||||| || |||||||| |
|
|
T |
54306979 |
ccgctggccggagacggctcagctccttgtagctcagccccgatgatgaattcaacttcgattttgcttt-gaatgggaacctgacctctccctcgatct |
54307077 |
T |
 |
Q |
206 |
ccgatcatcatcggaaccaaaaatatctccataaaacgcatcattcttcgccggaatcctgaacaccggcaagttccggccactttttgccggcgccgga |
305 |
Q |
|
|
||| ||||| || |||||||||||||| | | |||| ||||| || ||||||||||| |||||| |||| ||||| |||| | ||||| |
|
|
T |
54307078 |
ccggtcatcgtccgaaccaaaaatatcgctgttaaacatgtcattttttgccggaatcctaaacacccgcaaactccgg-------ttgctg---ccgga |
54307167 |
T |
 |
Q |
306 |
gacacaaacgccggctgtttgaaaatttcttcgtagaaagaaccggtcctggagaatttgtgagtgaggaggcttctaggtggacctccgaagacgtcgg |
405 |
Q |
|
|
|| |||| | ||||| |||||||||| || |||||||| | | ||||||||||||||| ||||||||||| ||||||||| |||| |||||||||| |
|
|
T |
54307168 |
gaagcaaaatc-ggctgcttgaaaatttgctctcagaaagaatcagacctggagaatttgtgtgtgaggaggctcctaggtggatctccaaagacgtcgg |
54307266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 526 times since January 2019
Visitors: 3481