View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_2D_high_6 (Length: 270)
Name: NF0493_2D_high_6
Description: NF0493_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_2D_high_6 |
 |  |
|
[»] scaffold0002 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 14 - 270
Target Start/End: Original strand, 342763 - 343019
Alignment:
Q |
14 |
ttggtgttgcagggggactcttgtgaataacggttggtgctggagctggtgcttgatgtctcctgtgcttgtgtctatgtcttcttctcttgtgcttgga |
113 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
342763 |
ttggtggtgcagggggactcttgtgaataacggttggtgctggagctggtgcttgatgtctcctgtgcttgtgtctatgtcttcttctcttgtgcttgga |
342862 |
T |
 |
Q |
114 |
ggactcaggtgctggtacaggtgcttctattgcaggcgttggtgcgggtattggtggtgaagtagcaggtgcaggagttggcgcttgctttgcgggtgca |
213 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
342863 |
ggactcaggtgctggtacaggtgcttctattgcaggcgttggtgcgggtattggtggtgaggtagcaggtgcaggagttggcgcttgctttgcgggtgca |
342962 |
T |
 |
Q |
214 |
ggtgctggcaccggtgttgcctttactggtgcaggggctggtggtgtttggactggt |
270 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
342963 |
ggtgctggcaccggtgttgcctttactggtgcaggggctggtggtgtttggactggt |
343019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 567 times since January 2019
Visitors: 3483