View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_2D_high_7 (Length: 270)
Name: NF0493_2D_high_7
Description: NF0493_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_2D_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 24169786 - 24169536
Alignment:
| Q |
18 |
aaatagacaacgttgcatgttcattgttaccaccaaaaccctcagaacaacaattttgtctttcactccgcaatggtctcattctctgcaacgtcctcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24169786 |
aaatagacaacgttgcatgttcattgttaccaccaaaaccctcagaacaacaattttgtctttcactccgcaatggtctcattctctgcaacgtcctcaa |
24169687 |
T |
|
| Q |
118 |
caaagtgaatcctggtgctgttgttaaagtcgtggacaatccagcacttgctgctgctgcttcagttgaaggagcagcacattctgctattcagtatttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24169686 |
caaagtgaatcctggtgctgttgttaaagtcgtggacaatccagcacttgctgctgctgcttcagttgaaggagcagcacattctgctattcagtatttt |
24169587 |
T |
|
| Q |
218 |
gagaatatgagaaactttctttatgctgttaaggatatgcaactcttgact |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24169586 |
gagaatatgagaaactttctttatgctgttaaggatatgcaactcttgact |
24169536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 83 - 160
Target Start/End: Complemental strand, 42238922 - 42238845
Alignment:
| Q |
83 |
ctccgcaatggtctcattctctgcaacgtcctcaacaaagtgaatcctggtgctgttgttaaagtcgtggacaatcca |
160 |
Q |
| |
|
||||||||||| |||||||| |||||||| ||||||||||| ||||| |||||| | | ||||| |||||||||||| |
|
|
| T |
42238922 |
ctccgcaatggcctcattctttgcaacgttctcaacaaagtcaatccgggtgctatcctcaaagtggtggacaatcca |
42238845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 411 times since January 2019
Visitors: 3476