View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_2D_low_11 (Length: 351)
Name: NF0493_2D_low_11
Description: NF0493_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_2D_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 30995560 - 30995225
Alignment:
| Q |
1 |
cctatactatcatttgcagcaacagatccaacactaacttcactagagttcccatattttgttaggacaacacagagtgatctgaatcaaatggctgctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30995560 |
cctatactatcatttgcagcaacagatccaacactaacttcactagagttcccatattttgttaggacaacacagagtgatctgaatcaaatggctgctg |
30995461 |
T |
 |
| Q |
101 |
tggcagacattgttgaccattttcaatggagagatgtgatagcaattttcatagatgatgatcatggaagaaatgggatagctgcattaggtgataagct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30995460 |
tggcagacattgttgaccattttcaatggagagatgtgatagcaattttcatagatgatgatcatggaagaaatgggatagctgcattaggtgataagct |
30995361 |
T |
 |
| Q |
201 |
agcagagaaacatagtaaaatatcatataaagcagctcttagacctgatcaactcaccactgatgaaataaacaatgctttatttaaagtagctttgatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
30995360 |
agcagagaaacatagtaaaatatcatataaagcagctcttagacctgatcaactcaccactgatgaaataaacaatgcattatttaaggtagctttgatg |
30995261 |
T |
 |
| Q |
301 |
gagtctagagtaattgtccttcatgtaacccttcat |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30995260 |
gagtctagagtaattgtccttcatgtaacccttcat |
30995225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University