View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_2D_low_22 (Length: 216)
Name: NF0493_2D_low_22
Description: NF0493_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_2D_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 39037953 - 39038034
Alignment:
| Q |
1 |
aatttataagatttcataatgttttatgaaatttaattgagagtcgttcctacagttttacgggttttaggtgtaatatgat |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
39037953 |
aatttataagatttcataatgttttatgaaatttaactgagagtcgttcctagagttttacaggttttaggtgtaatatgat |
39038034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 132 - 200
Target Start/End: Complemental strand, 40458178 - 40458105
Alignment:
| Q |
132 |
ctctgacaaaattatctttgtttactaactaaaata-----agcatttaaaacaataatttttaattggttcat |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
40458178 |
ctctgacaaaattatgtttgtttactaactaaaatataataagcatttaaaataataatttttaattggttcat |
40458105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University