View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_2D_low_6 (Length: 427)
Name: NF0493_2D_low_6
Description: NF0493_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_2D_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 139 - 409
Target Start/End: Original strand, 45980603 - 45980873
Alignment:
| Q |
139 |
atggttctataagcattgttttgtttacttggcagtgaccctgctcagcgcccatcttttggaggcataattgagtcactaaggaagctcctgaagtctc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45980603 |
atggttctataagcattgttttgtttacttggcagtgaccctgctcagcgcccatcttttggaggcataattgagtcactaaggaagctcctgaagtctc |
45980702 |
T |
 |
| Q |
239 |
caacagagatgataaaaatgggtgatactcacaacccataattggttttcttgttgctgaaatttgttgaactaataaggaaacattggtagtcgtatat |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45980703 |
caacagagatgataaaaatgggtgatactcacaacccataattggttttcttgttgctgaaatttgttgaactaataaggaaacattggtagtcgtatat |
45980802 |
T |
 |
| Q |
339 |
catctgaatgacagaaccttggctgtttgcaactgtatattgtaatttaaaggctcaaataggtgctgtct |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45980803 |
catctgaatgacagaaccttggctgtttgcaactgtatattgtaatttaaaggctcaaataggtgctgtct |
45980873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 69; Significance: 8e-31; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 41 - 109
Target Start/End: Complemental strand, 47861110 - 47861042
Alignment:
| Q |
41 |
gttgcataaattaatgtagggcagaggaaagtcacacactgtttttaaaataaaaataattaacaggca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47861110 |
gttgcataaattaatgtagggcagaggaaagtcacacactgtttttaaaataaaaataattaacaggca |
47861042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University