View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_high_35 (Length: 378)
Name: NF0493_high_35
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 30 - 281
Target Start/End: Original strand, 42190181 - 42190434
Alignment:
Q |
30 |
acaagtaacatttaaaacaggtgaaaaaatatgtacagatgcattgcatggaattcgatccatataatttgaaatcacgataagtctct-aagtttggct |
128 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |||||||||| |
|
|
T |
42190181 |
acaagtaacatttaaaacaggtgaaaaa-tatgtacagatgcattgcatggaattcgatccatagaatttgaaatcatgataagtctcttaagtttggct |
42190279 |
T |
 |
Q |
129 |
tcatgaaagccatagagtgactttaggtatgaaactcaaatgtgataagcttttaagtccaaaccttctacatttttaaattggtaaagttgattaggct |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
T |
42190280 |
tcatgaaagccatagagtgactttaggtatgaaactcaaatgtgataagcttttaagtccaaaccttctaaagttttaaattggtaaagttgattaggct |
42190379 |
T |
 |
Q |
229 |
gaaaac--tgtgaccaaaataaggtaggtataagtaatgaacttagattactcct |
281 |
Q |
|
|
|||||| |||||||||||||||||| ||||||||||| ||||| |||| ||||| |
|
|
T |
42190380 |
gaaaactatgtgaccaaaataaggtatgtataagtaattaacttcgatttctcct |
42190434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University