View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_high_41 (Length: 352)
Name: NF0493_high_41
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 81 - 259
Target Start/End: Complemental strand, 8005847 - 8005671
Alignment:
Q |
81 |
gaactggaaaattaagttggtgatgata-taattgggaataacattagaacgacggagaagtgaattgctccnnnnnnntccagttactgcag-nnnnnn |
178 |
Q |
|
|
|||||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
8005847 |
gaactggaaaattaagttggtggtgaaactaattgggaataacattagaacgacggagaagtgaattgctccaaaaaaaaccagttactgcagtttttat |
8005748 |
T |
 |
Q |
179 |
nnncaattt---atgatcggttttccccagtgtgacggtggatcgacaaatttcattttcataaacaatggcgagtgaattaat |
259 |
Q |
|
|
|||||| ||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8005747 |
tttcaatttataatgatcggttttccccaatgtgacg-------gacaaatttcattttcataaacaatggcgagtgaattaat |
8005671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 182 - 239
Target Start/End: Complemental strand, 9849235 - 9849178
Alignment:
Q |
182 |
caatttatgatcggttttccccagtgtgacggtggatcgacaaatttcattttcataa |
239 |
Q |
|
|
|||||||| || ||||||| ||| ||| ||||||||||||||||||||||||||||| |
|
|
T |
9849235 |
caatttattattggttttcaccaatgtatcggtggatcgacaaatttcattttcataa |
9849178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 130
Target Start/End: Complemental strand, 9849355 - 9849306
Alignment:
Q |
81 |
gaactggaaaattaagttggtgatgatataattgggaataacattagaac |
130 |
Q |
|
|
||||||||||||||||||| || ||| ||||||||||| |||||||||| |
|
|
T |
9849355 |
gaactggaaaattaagttgttggtgaactaattgggaattacattagaac |
9849306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 349 times since January 2019
Visitors: 3470