View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0493_high_41 (Length: 352)

Name: NF0493_high_41
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0493_high_41
NF0493_high_41
[»] chr2 (1 HSPs)
chr2 (81-259)||(8005671-8005847)
[»] chr1 (2 HSPs)
chr1 (182-239)||(9849178-9849235)
chr1 (81-130)||(9849306-9849355)


Alignment Details
Target: chr2 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 81 - 259
Target Start/End: Complemental strand, 8005847 - 8005671
Alignment:
81 gaactggaaaattaagttggtgatgata-taattgggaataacattagaacgacggagaagtgaattgctccnnnnnnntccagttactgcag-nnnnnn 178  Q
    |||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||        |||||||||||||           
8005847 gaactggaaaattaagttggtggtgaaactaattgggaataacattagaacgacggagaagtgaattgctccaaaaaaaaccagttactgcagtttttat 8005748  T
179 nnncaattt---atgatcggttttccccagtgtgacggtggatcgacaaatttcattttcataaacaatggcgagtgaattaat 259  Q
       ||||||   ||||||||||||||||| |||||||       ||||||||||||||||||||||||||||||||||||||||    
8005747 tttcaatttataatgatcggttttccccaatgtgacg-------gacaaatttcattttcataaacaatggcgagtgaattaat 8005671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 182 - 239
Target Start/End: Complemental strand, 9849235 - 9849178
Alignment:
182 caatttatgatcggttttccccagtgtgacggtggatcgacaaatttcattttcataa 239  Q
    |||||||| || ||||||| ||| |||  |||||||||||||||||||||||||||||    
9849235 caatttattattggttttcaccaatgtatcggtggatcgacaaatttcattttcataa 9849178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 130
Target Start/End: Complemental strand, 9849355 - 9849306
Alignment:
81 gaactggaaaattaagttggtgatgatataattgggaataacattagaac 130  Q
    ||||||||||||||||||| || |||  ||||||||||| ||||||||||    
9849355 gaactggaaaattaagttgttggtgaactaattgggaattacattagaac 9849306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 349 times since January 2019
Visitors: 3470