View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_high_43 (Length: 349)
Name: NF0493_high_43
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_high_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 30 - 344
Target Start/End: Original strand, 38068898 - 38069212
Alignment:
Q |
30 |
tttacaactgacaagttgtgaagcattggaaggttactaattgcaaggaaattgaactctccgaccaaactagcattgtccaaagtgatggatataacat |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38068898 |
tttacaactgacaagttgtgaagcattggaaggttactaattgcaaggaaattgaactctccgaccaaactagcattgtccaaagtgatggatataacat |
38068997 |
T |
 |
Q |
130 |
tgccttcactacacaatatcccataccagttctgaggacatccattagattctaatgacttggaatcccaagaattaagaactaatccaaaagggtcatt |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38068998 |
tgccttcactacacaatatcccataccagttctgaggacatccattagattctaatgacttggaatcccaagaattaagaactaatccaaaagggtcatt |
38069097 |
T |
 |
Q |
230 |
ttgaatacccttcttgagttcaagaagtgcatcaatgtctctattcccaaatgcagtattcacaaacaacaacagcatcaaccagatagcctgcattcct |
329 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
38069098 |
ttgaatacccttcttgagttcaagaagtgcatcaatgtctctattcccaaatgcagtattcaccaacaacaacagcatcaaccagatagcctgcattcct |
38069197 |
T |
 |
Q |
330 |
ttcctctctgctcct |
344 |
Q |
|
|
||||| ||||||||| |
|
|
T |
38069198 |
ttcctatctgctcct |
38069212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 629 times since January 2019
Visitors: 3486