View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_high_56 (Length: 314)
Name: NF0493_high_56
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_high_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 42 - 221
Target Start/End: Complemental strand, 8005847 - 8005671
Alignment:
| Q |
42 |
gaactggaaaattaagttggtgatgata-taattgggaataacattagaacgacggagaagtgaattgctccnnnnnnntccagttactgcagnnnnnnn |
140 |
Q |
| |
|
|||||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8005847 |
gaactggaaaattaagttggtggtgaaactaattgggaataacattagaacgacggagaagtgaattgctccaaaaaaaaccagttactgcagtttttat |
8005748 |
T |
|
| Q |
141 |
nnncaattt---atgatcggttttccccagtgtgacggtggatcgacaaatttcattttcataaacaatggcgagtgaattaat |
221 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8005747 |
tttcaatttataatgatcggttttccccaatgtgacg-------gacaaatttcattttcataaacaatggcgagtgaattaat |
8005671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 144 - 201
Target Start/End: Complemental strand, 9849235 - 9849178
Alignment:
| Q |
144 |
caatttatgatcggttttccccagtgtgacggtggatcgacaaatttcattttcataa |
201 |
Q |
| |
|
|||||||| || ||||||| ||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
9849235 |
caatttattattggttttcaccaatgtatcggtggatcgacaaatttcattttcataa |
9849178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 91
Target Start/End: Complemental strand, 9849355 - 9849306
Alignment:
| Q |
42 |
gaactggaaaattaagttggtgatgatataattgggaataacattagaac |
91 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||||||| |||||||||| |
|
|
| T |
9849355 |
gaactggaaaattaagttgttggtgaactaattgggaattacattagaac |
9849306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 763 times since January 2019
Visitors: 3491