View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0493_high_59 (Length: 296)

Name: NF0493_high_59
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0493_high_59
NF0493_high_59
[»] chr1 (1 HSPs)
chr1 (103-222)||(12504115-12504225)


Alignment Details
Target: chr1 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 103 - 222
Target Start/End: Original strand, 12504115 - 12504225
Alignment:
103 agctattagtgaatttgttcgcttttaaatttaaagcactgaaaaattggttggacaatttgcttggtgtaaattgtctttagttcgaccccacagctaa 202  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||    
12504115 agctattagtgaatttgttcgctttcaaatttaaagcactgaaaaattggttggacaatttgcttggtgtaaat---------ttcgaccccacagctaa 12504205  T
203 tctataagtgaaattataaa 222  Q
    ||||||||||||||||||||    
12504206 tctataagtgaaattataaa 12504225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 288 times since January 2019
Visitors: 3469