View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_high_75 (Length: 261)
Name: NF0493_high_75
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_high_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 8822776 - 8823007
Alignment:
Q |
1 |
ccgcaaaagttttagctgcacttttcaataatgcttcaggactatcgtcgcgagaaggcgaatcccacaaccttgacggagtcatacagttcatagaaga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
8822776 |
ccgcaaaagttttagctgcacttttcaataatgcttcaggactatcatcgcgagaaggcgagtcccacaaccttgacggagtcatacagttcatagaaga |
8822875 |
T |
 |
Q |
101 |
catcataaactggcggatacccagaggactaaattcttgctgcatatcacccccagattgtacaagatcacagctcaggaaaggaatatccaagcttgga |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8822876 |
catcataaactggcggatacccagaggactaaattcttgctgcatatcacccccagattgtacaagatcacagctcaggaaaggaatatccaagcttgga |
8822975 |
T |
 |
Q |
201 |
aaacggggaggttcataacatagtgctccatt |
232 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
8822976 |
aaacggggaggttcataacatagtgctccatt |
8823007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 6 - 223
Target Start/End: Complemental strand, 50893736 - 50893522
Alignment:
Q |
6 |
aaagttttagctgcacttttcaataatgcttcaggactatcgtcgcgagaaggcgaatcccacaaccttgacggagtcatacagttcatagaagacatca |
105 |
Q |
|
|
||||||||||| |||||||| || || || || |||||||| ||||||||| || |||||||| || | ||||||| |||||||||||||||||||| |
|
|
T |
50893736 |
aaagttttagcagcactttttaacaaagcgtccggactatcaatgcgagaaggtgagtcccacaatctgaaaggagtcagacagttcatagaagacatca |
50893637 |
T |
 |
Q |
106 |
taaactggcggatacccagaggactaaattcttgctgcatatcacccccagattgtacaagatcacagctcaggaaaggaatatccaagcttggaaaacg |
205 |
Q |
|
|
|||||||||||||||| | |||||||||||||||||||||| | |||||||||| |||||||||||||| |||||| |||||||||||||||||||| |
|
|
T |
50893636 |
taaactggcggatacctaagggactaaattcttgctgcatat---ctccagattgtataagatcacagctcaagaaaggtatatccaagcttggaaaacg |
50893540 |
T |
 |
Q |
206 |
gggaggttcataacatag |
223 |
Q |
|
|
||| |||||||||||||| |
|
|
T |
50893539 |
gggcggttcataacatag |
50893522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 761 times since January 2019
Visitors: 3491