View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_high_80 (Length: 251)
Name: NF0493_high_80
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_high_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 125 - 244
Target Start/End: Original strand, 5434056 - 5434175
Alignment:
Q |
125 |
aattaactaactaaagtaattgaataaaatccttcgatttcgattgcaattttgctatcccgtatcaatcgtacaaaagccagttgagtaaaatcctcga |
224 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5434056 |
aattaactaactaaagtaattgaataaaatccttcgatttcgattgcaattttgctatcccgtatcaatcgtacaaaagccagttgagtaaaatcctcga |
5434155 |
T |
 |
Q |
225 |
ttttgattttgctgtcccct |
244 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
5434156 |
ttttgattttgctgtcccct |
5434175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 638 times since January 2019
Visitors: 3486