View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_high_83 (Length: 250)
Name: NF0493_high_83
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_high_83 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 27 - 250
Target Start/End: Complemental strand, 8171970 - 8171747
Alignment:
Q |
27 |
tcacaatctacaagaacaaaatcagctcctttgtagtcatttaagagaagggttttagcatctcctactacaaactcaacactatctttatgaactccta |
126 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
8171970 |
tcacaatctacaagaacaaaatcagctcctttgtagtcatttaagagaagggttttagcatctcctacaacaaactcaacactatctttatgaactccta |
8171871 |
T |
 |
Q |
127 |
aagcttctttggatgcttgtaattcattttgtccaaatgaaatgtataccacacggccgtgtgtttgttgagaggccgcagctagtgctagcgtggtaga |
226 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8171870 |
aagcttctttggatgcttgtaattcattttgtccagatgaaatgtatatcacacggccgtgtgtttgttgagaggccgcagctagtgctagcgtggtaga |
8171771 |
T |
 |
Q |
227 |
actagccacgttagcacttgctac |
250 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
8171770 |
actagccacgttagcacttgctac |
8171747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 339 times since January 2019
Visitors: 3470