View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_high_86 (Length: 228)
Name: NF0493_high_86
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_high_86 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 5434602 - 5434392
Alignment:
| Q |
18 |
tctatatttgctttcattgttgattgtttctgattttgctttccatgaaggaagacaggctgttcttttcatgtgctttaatgttgttctacaaaagggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5434602 |
tctatatttgctttcattgttgattgtttctgattttgctttccatgaaggaagacaggctgttcttttcatgtgctttaatgttgttctacaaaagggt |
5434503 |
T |
 |
| Q |
118 |
tttgacatttttcatccatattcaagtgtggaaattcattgtccttcacaatagatcatcctggacctgcttcgtagcnnnnnnnnaaggagatcttctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5434502 |
tttgacatttttcatccatattcaagtttggaaattcattgtccttcacaatagatcatcctggacctgcttcgtagcttttttctaaggagatcttctt |
5434403 |
T |
 |
| Q |
218 |
gcggtgtgtat |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
5434402 |
gcggtgtgtat |
5434392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University