View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_high_88 (Length: 228)
Name: NF0493_high_88
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_high_88 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 8293643 - 8293773
Alignment:
| Q |
1 |
gatattttgttgctgcgttttgtatagcgtccgtgtcatgtgcatttgatctccatataattaattgcatctctggtttaggtgctannnnnnnaataac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8293643 |
gatattttgttgctgcgttttgtatagcgtccgtgtcatgtgcatttgatctccatataattaattgcatctctggtttaggtgctatttttttaataac |
8293742 |
T |
|
| Q |
101 |
aaatgtagaatattagtatgttaatagttag |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8293743 |
aaatgtagaatattagtatgttaatagttag |
8293773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 762 times since January 2019
Visitors: 3491