View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0493_high_92 (Length: 205)

Name: NF0493_high_92
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0493_high_92
NF0493_high_92
[»] chr6 (1 HSPs)
chr6 (57-190)||(54642-54775)


Alignment Details
Target: chr6 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 57 - 190
Target Start/End: Complemental strand, 54775 - 54642
Alignment:
57 ccatagattacatttcaatattattagctagatagattacatgatggaacatgcatttacattgtcatcgttaaaaagggagacaagtaattcttcttga 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54775 ccatagattacatttcaatattattagctagatagattacatgatggaacatgcatttacattgtcatcgttaaaaagggagacaagtaattcttcttga 54676  T
157 tgattggatgaggccataggggcagcctgcacaa 190  Q
    ||||||||||||||||||||||||||||||||||    
54675 tgattggatgaggccataggggcagcctgcacaa 54642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University