View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_high_94 (Length: 203)
Name: NF0493_high_94
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_high_94 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 12 - 185
Target Start/End: Complemental strand, 33638932 - 33638759
Alignment:
| Q |
12 |
agctgttgctgtagaagaaaacactgattgcattagctttgaattccgagtcatgttgtacgacataggaatacattttaaccatttgtggttgaggatt |
111 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33638932 |
agctgttgctgtagaagaaaaaactgattgcattagctttgaattccaagtcatgctgtacgacataggaaaacattttaaccatttgtggttgaggatt |
33638833 |
T |
 |
| Q |
112 |
tgtcttccgtatgttagacattgctatactgatcattcaacccatggagaaattgcatttgatcatatgccttt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
33638832 |
tgtcttccgtatgttagacattgctatactgatcattcagcccatggagaaattgcatttgatcttatgccttt |
33638759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University