View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_112 (Length: 222)
Name: NF0493_low_112
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_low_112 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 3 - 118
Target Start/End: Complemental strand, 362604 - 362489
Alignment:
Q |
3 |
tgttcttgctttaaaatcaattcaaatcccaggcattgtgtaataatcagaaccatctnnnnnnncaaagaactagtgggcaatagtgtaaattaaccaa |
102 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
T |
362604 |
tgttcttgctttaaaatcaattcaaatcccagacattgtgtaataatcagaaccatctaaaaaagcaaagaactagtgggcaatagtgtaaattaatcaa |
362505 |
T |
 |
Q |
103 |
taaatcagctcttatt |
118 |
Q |
|
|
|||||||||||||||| |
|
|
T |
362504 |
taaatcagctcttatt |
362489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 374 times since January 2019
Visitors: 3472